![]() |
Data transfer format - MORGAM polymorphisms
|
|
© National Institute for Health and Welfare
and the MORGAM Project investigators Last updated: 2011-01-14 For more information, please contact Päivi Laiho (firstname.lastname@thl.fi), Ari Haukijärvi (ari.haukijarvi@thl.fi) or Kari Kuulasmaa (kari.kuulasmaa@thl.fi) |
The purpose of this transfer format is to provide an exact and common format for the MORGAM Genotyping Laboratories (GLAB) to transfer data on MORGAM polymorphisms to the MORGAM Data centre (MDC) at National Institute for Health and Welfare (THL). The data should be sent through e-mail.
| NAME | SPECIFICATION AND CODES | FORMAT or Value | |
|---|---|---|---|
| FORM | Form number | I2 | |5|1| |
| VERSION | Version of this form | I1 | |6| |
| GLAB | Genotyping Laboratory code (GLAB), selected from the list of genotyping laboratories | I3 | |_|_|_| |
| SHIPMENT | Shipment number | I5 | |_|_|_|_|_| |
| SHIPDATE | Date of this shipment (date ANSI) YYYYMMDD (year month day) |
C8 | |_|_|_|_||_|_||_|_| |
| MARKER | SNP / polymorphism name (abbreviation) as used locally | C30 | free text |
| GENE_NAME | Gene name as defined in NCBI Entrez Gene database | C20 | free text |
| GENOTYPE | Genotype coding | C10 | free text |
| DELINS | Deletion / insertion coding | C10 | free text |
| 5PRIME | 5' flanking sequence | C30 | free text |
| 3PRIME | 3' flanking sequence | C30 | free text |
| RS | ID of this polymorphism in RS database | C10 | free text |
| ORIGINAL_PROJECT | The name of the original project of the SNP | C50 | free text |
| COMMENT | Comments by the laboratory regarging the SNP (if any) | C100 | free text |
The item NAME on the document is a computer variable name used for the item by the MDC.
| FORMAT | Type | Format | Example | Comments |
|---|---|---|---|---|
| C | Character | C8 | 20090205 | Used for dates, trailing zeroes are mandatory. |
| C20 | "B 17 E" | Location of sample in box; surround with double quotes (") if value contains spaces. Maximum of 20 characters allowed for this variable, including quotes. | ||
| C3 | -80 | Storage temperature, includes leading '-' sign. | ||
| F | Float | F5.2 | 13.1 2.18 |
Variable must include a decimal point (.). Leading and trailing zeroes are not mandatory. |
| I | Integer | I3 | 1 15 180 |
Leading zeroes are not mandatory. |
Instructions for making corrections to data that have already been sent to the MDC are
given in Section Data communication between the
Participating Centres and the MDC.
Please contact the MDC for instructions if you can not provide information as specified in
this document or if you have any problems with the interpretation of the coding for any
specific items.
Follow these instructions carefully when creating a computer file for the data transfer from the GLAB to the MDC.
| FORM | Form number | I2 | |5|1| |
|---|
Number 51 indicates the "Data transfer format: MORGAM polymorphisms".
| VERSION | Version of this form | I1 | |6| |
|---|
Current version of this data transfer format. If the version number of the data transfer format which you are using is not "2", these instructions do not correspond to the format you are using. Version number changes if some major changes are introduced in the form, for example adding / deleting some variables.
| GLAB | Genotyping Laboratory code | C3 | |_|_|_| |
|---|
Enter appropriate code of your MORGAM Genotyping Laboratory from the list of MORGAM Genotyping Laboratories:
| SHIPMENT | Shipment number | I5 | |_|_|_|_|_| |
|---|
This is shipment number from genotyping laboratory to MDC. Usually it is a
sequential number of shipments to MDC. If you do nof use it, enter
number of shipment to MDC on that particular day.
| SHIPDATE | Date of this shipment (date ANSI) YYYYMMDD (year month day) |
C8 | |_|_|_|_||_|_||_|_| |
|---|
The date of the shipment (the date when you completed this data form). Format is yyyymmdd (date ANSI, 8 characters, year day month).
| MARKER | SNP / polymorphism name (abbreviation) as used locally | C30 | free text |
|---|
Enter the SNP / polymorphism name (abbreviation) as used in local database.
| GENE_NAME | Gene name as defined in NCBI Entrez Gene database | C20 | free text |
|---|
Enter the gene name (abbreviation) as defined in NCBI Entrez Gene database. The Form 50 "Data transfer format - MORGAM genes" should be sent to MDC containing data on this gene.
| GENOTYPE | Genotype coding | C10 | free text |
|---|
Enter here alleles in capital letters: A, C, T, G, from both chromosomes separated by slash (/). Deletions are marked as D, not genotyped data as N; for example:
| DELINS | Deletion / insertion coding | C10 | free text |
|---|
Enter here allele codes for deletion and insertion separated by slash (/), for example:
| 5PRIME | 5' flanking sequence | C30 | free text |
|---|
Enter here the 5' flanking sequence, 30 characters.
| 3PRIME | 3' flanking sequence | C30 | free text |
|---|
Enter here the 3' flanking sequence, 25 characters.
| RS | ID of this polymorphism in RS database | C10 | free text |
|---|
Enter here the ID of this polymorphism in the RS database (if exists), for example: rs153311
| ORIGINAL_PROJECT | Enter here the name of the original project of the SNP | C50 | free text |
|---|
The name of the original project in which this polymorphism was first used. See the available project codes at ???. If you have any uncertainty about the project, please contact the MCL for instructions.
| COMMENT | Comments by the laboratory regarging the SNP (if any) | C100 | free text |
|---|
Enter here Comments by the laboratory regarging the SNP (if any), for example if the SNP is a proxy for another SNP.
The data should be prepared in ASCII comma-delimited format using semicolon (;) as delimiter, with the names of the variables in the first row. If the value of a variable contains text with delimiter used inside the text then the value should be surrounded by double quotes ("). A dot (.) shold be used as a decimal point.
To simplify the tracing of data transfers between the MPC and the MDC, the files should be named as follows:
F51_GLAB_YYYYMMDD_N.CSV, where:
To avoid possible errors in variable naming use the first row from the example below containing variable names. Example of Form 51 ASCII comma-delimited data file:
|
FORM;VERSION;GLAB;SHIPMENT;SHIPDATE;MARKER;GENE_NAME;GENOTYPE;DELINS;5PRIME;3PRIME;RS;ORIENTATION;ORIGINAL_PROJECT;COMMENT 51;4;911;1;20090127;ICAM1_36;ICAM1;A/G;;gagcactcaaggggaggtcacccgc;aggtgaccgtgaatgtgctctgtga;rs5030382;F;MORGAM; |
The data files should be archived (ZIP format) before sending them to the MDC. The archive names should be the same as the file names. MORGAM data Error checking program will be used to prepare data (will be available later). The data should be sent to MDC (ari.haukijarvi@thl.fi) as an attachment to an e-mail message. Please make sure to save a copy of the transferred files in the sending MPC or laboratory.
When the data are received in the MDC, an acknowledgement will be sent to the sender. The data will then be checked for consistency and quality, and after any problems have been resolved, they will be entered into the MORGAM database.
|
To the top of the form |